# -------------------------------------------------------------------
# File name: slice.py
#
# s[i:j:k] slice of s from i to j with step k
#
# The slice of s from i to j is defined as the sequence of items with
# index k such that i <= k < j. If i or j is greater than len(s), use len(s).
# If i is omitted or None, use 0. If j is omitted or None, use len(s).
# If i is greater than or equal to j, the slice is empty.
#
# If i or j is negative, the index is relative to the end of sequence
# s: len(s) + i or len(s) + j is substituted. But note that -0 is still 0.
#
# The code below illustrates the use of slicing in extraction of
# subsequences from a DNA sequence.
#
# Version: 2.1
# Authors: H. Kocak and B. Koc
#          University of Miami and Stetson University
# References:
# https://docs.python.org/3/tutorial/introduction.html#strings
# https://docs.python.org/3/library/stdtypes.html#str.find
# https://docs.python.org/3/library/stdtypes.html#common-sequence-operations
# https://docs.python.org/3/library/stdtypes.html#text-sequence-type-str
# https://en.wikipedia.org/wiki/DNA_codon_table
# https://en.wikipedia.org/wiki/D-loop
# https://www.ncbi.nlm.nih.gov/nuccore/X90314.1?report=fasta
# ------------------------------------------------------------------

human = 'TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATT'
print('Human D-loop:', human)

mycodon = 'CAT'

# Find the lowest index of mycodon in human
index_mycodon = human.find(mycodon)
print('First', mycodon, 'index:', index_mycodon)

# Extract the first codon after mycodon
first_codon = human[index_mycodon + 3: index_mycodon + 6]
print('First codon after', mycodon, ':', first_codon)

# Extract the second codon after mycodon
second_codon = human[index_mycodon + 6: index_mycodon + 9]
print('Second codon after', mycodon, ':', second_codon)

# Negative starting point counts from the end of the string.
next_to_last_codon = human[-6:-3]
print('Next to last codon:', next_to_last_codon)

# Omitted second entry in slicing indicates to the end of string
last_codon = human[-3:]
print('Last codon:', last_codon)